Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pAF156
 
Resource Report
Resource Website
RRID:Addgene_222388 IL6 Other Ampicillin PMID:39017897 Plasmid generated by Gibson assembly using NotI and SmaI sites. Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF138; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:28 0
pCMV4-HA-p31(comet)
 
Resource Report
Resource Website
RRID:Addgene_221697 MAD2BP1 Homo sapiens Ampicillin PMID:37468549 Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:28 0
pAF237
 
Resource Report
Resource Website
RRID:Addgene_222389 mCherry Synthetic Ampicillin PMID:39017897 Plasmid generated by Gibson assembly using NotI and SmaI sites. Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF137; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:28 0
pCMV4-HA-MAD2
 
Resource Report
Resource Website
RRID:Addgene_221696 MAD2 Homo sapiens Ampicillin PMID:37468549 Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:28 0
eScaf
 
Resource Report
Resource Website
RRID:Addgene_220921 Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 E. coli None PMID:38499480 Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-09-12 02:41:28 0
DVK_p15A_GH
 
Resource Report
Resource Website
RRID:Addgene_217586 Kanamycin PMID:39801078 Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin None 2026-09-12 02:41:28 0
pET28a_MBP_RBFOX2
 
Resource Report
Resource Website
RRID:Addgene_224292 RNA binding fox-1 homolog 2 Homo sapiens Kanamycin PMID:37640841 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:41:29 0
DVK_p15A_EF
 
Resource Report
Resource Website
RRID:Addgene_217584 Kanamycin PMID:39801078 Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin None 2026-09-12 02:41:28 0
DVC_p15A_AF
 
Resource Report
Resource Website
RRID:Addgene_217588 Chloramphenicol PMID:39801078 Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol None 2026-09-12 02:41:28 0
pcDNA4.1-Myc-RNF8-T198A
 
Resource Report
Resource Website
RRID:Addgene_221680 RNF8 Homo sapiens Ampicillin PMID:37468549 This is a mutated version of plasmid #221676. Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T198A 2026-09-12 02:41:28 0
pcDNA4.1-Myc-RNF8-3A
 
Resource Report
Resource Website
RRID:Addgene_221681 RNF8 Homo sapiens Ampicillin PMID:37468549 This is a mutated version of plasmid #221676. Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R477A, E478A, R479A 2026-09-12 02:41:28 0
pcDNA3.1-Myc-BirA*-RNF8-R42A
 
Resource Report
Resource Website
RRID:Addgene_221684 RNF8 Homo sapiens Ampicillin PMID:37468549 This is a mutated version of plasmid #221683. Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R42A 2026-09-12 02:41:28 0
pEY121
 
Resource Report
Resource Website
RRID:Addgene_223468 sra-6 Caenorhabditis elegans Ampicillin PMID:33378642 Vector Backbone:pPD95.62; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:28 0
pcDNA3.1-Myc-BirA*-RNF8-C403S
 
Resource Report
Resource Website
RRID:Addgene_221685 RNF8 Homo sapiens Ampicillin PMID:37468549 This is a mutated version of plasmid #221683. Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C403S 2026-09-12 02:41:28 0
DVC_pBR322_AE
 
Resource Report
Resource Website
RRID:Addgene_217597 Chloramphenicol PMID:39801078 Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol None 2026-09-12 02:41:28 0
DVC_pBR322_AF
 
Resource Report
Resource Website
RRID:Addgene_217598 Chloramphenicol PMID:39801078 Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol None 2026-09-12 02:41:28 0
DVC_pBR322_EF
 
Resource Report
Resource Website
RRID:Addgene_217599 Chloramphenicol PMID:39801078 Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol None 2026-09-12 02:41:28 0
pDONR223_NKX2-1_V205F
 
Resource Report
Resource Website
RRID:Addgene_221473 NKX2-1 Homo sapiens Spectinomycin PMID:37994369 Cloning based on backbone of 371AA short isoform of NKX2-1 ORF Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin V205F 2026-09-12 02:41:29 0
CMV-pDisplay-SNAP
 
Resource Report
Resource Website
RRID:Addgene_223495 SNAP-tag Synthetic Ampicillin PMID:34777770 Backbone Marker:Invitrogen; Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:29 0
pET20b-mPTER-Y263F
 
Resource Report
Resource Website
RRID:Addgene_222204 PTER Mus musculus Ampicillin PMID:38562797 Please visit https://doi.org/10.1101/2024.03.21.586194 for bioRxiv preprint. Vector Backbone:pET-20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Y263F 2026-09-12 02:41:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.