Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAF156 Resource Report Resource Website |
RRID:Addgene_222388 | IL6 | Other | Ampicillin | PMID:39017897 | Plasmid generated by Gibson assembly using NotI and SmaI sites. | Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF138; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:28 | 0 | |
|
pCMV4-HA-p31(comet) Resource Report Resource Website |
RRID:Addgene_221697 | MAD2BP1 | Homo sapiens | Ampicillin | PMID:37468549 | Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:28 | 0 | ||
|
pAF237 Resource Report Resource Website |
RRID:Addgene_222389 | mCherry | Synthetic | Ampicillin | PMID:39017897 | Plasmid generated by Gibson assembly using NotI and SmaI sites. | Backbone Marker:Andrew S. Flies Lab; Vector Backbone:pAF137; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:28 | 0 | |
|
pCMV4-HA-MAD2 Resource Report Resource Website |
RRID:Addgene_221696 | MAD2 | Homo sapiens | Ampicillin | PMID:37468549 | Vector Backbone:pCMV4-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:28 | 0 | ||
|
eScaf Resource Report Resource Website |
RRID:Addgene_220921 | Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 | E. coli | None | PMID:38499480 | Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-12 02:41:28 | 0 | |
|
DVK_p15A_GH Resource Report Resource Website |
RRID:Addgene_217586 | Kanamycin | PMID:39801078 | Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | None | 2026-09-12 02:41:28 | 0 | |||
|
pET28a_MBP_RBFOX2 Resource Report Resource Website |
RRID:Addgene_224292 | RNA binding fox-1 homolog 2 | Homo sapiens | Kanamycin | PMID:37640841 | Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:41:29 | 0 | ||
|
DVK_p15A_EF Resource Report Resource Website |
RRID:Addgene_217584 | Kanamycin | PMID:39801078 | Vector Backbone:DVK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | None | 2026-09-12 02:41:28 | 0 | |||
|
DVC_p15A_AF Resource Report Resource Website |
RRID:Addgene_217588 | Chloramphenicol | PMID:39801078 | Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | None | 2026-09-12 02:41:28 | 0 | |||
|
pcDNA4.1-Myc-RNF8-T198A Resource Report Resource Website |
RRID:Addgene_221680 | RNF8 | Homo sapiens | Ampicillin | PMID:37468549 | This is a mutated version of plasmid #221676. | Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T198A | 2026-09-12 02:41:28 | 0 |
|
pcDNA4.1-Myc-RNF8-3A Resource Report Resource Website |
RRID:Addgene_221681 | RNF8 | Homo sapiens | Ampicillin | PMID:37468549 | This is a mutated version of plasmid #221676. | Vector Backbone:pcDNA4.1/TO/myc-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R477A, E478A, R479A | 2026-09-12 02:41:28 | 0 |
|
pcDNA3.1-Myc-BirA*-RNF8-R42A Resource Report Resource Website |
RRID:Addgene_221684 | RNF8 | Homo sapiens | Ampicillin | PMID:37468549 | This is a mutated version of plasmid #221683. | Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R42A | 2026-09-12 02:41:28 | 0 |
|
pEY121 Resource Report Resource Website |
RRID:Addgene_223468 | sra-6 | Caenorhabditis elegans | Ampicillin | PMID:33378642 | Vector Backbone:pPD95.62; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:28 | 0 | ||
|
pcDNA3.1-Myc-BirA*-RNF8-C403S Resource Report Resource Website |
RRID:Addgene_221685 | RNF8 | Homo sapiens | Ampicillin | PMID:37468549 | This is a mutated version of plasmid #221683. | Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C403S | 2026-09-12 02:41:28 | 0 |
|
DVC_pBR322_AE Resource Report Resource Website |
RRID:Addgene_217597 | Chloramphenicol | PMID:39801078 | Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | None | 2026-09-12 02:41:28 | 0 | |||
|
DVC_pBR322_AF Resource Report Resource Website |
RRID:Addgene_217598 | Chloramphenicol | PMID:39801078 | Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | None | 2026-09-12 02:41:28 | 0 | |||
|
DVC_pBR322_EF Resource Report Resource Website |
RRID:Addgene_217599 | Chloramphenicol | PMID:39801078 | Vector Backbone:DVC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | None | 2026-09-12 02:41:28 | 0 | |||
|
pDONR223_NKX2-1_V205F Resource Report Resource Website |
RRID:Addgene_221473 | NKX2-1 | Homo sapiens | Spectinomycin | PMID:37994369 | Cloning based on backbone of 371AA short isoform of NKX2-1 ORF | Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | V205F | 2026-09-12 02:41:29 | 0 |
|
CMV-pDisplay-SNAP Resource Report Resource Website |
RRID:Addgene_223495 | SNAP-tag | Synthetic | Ampicillin | PMID:34777770 | Backbone Marker:Invitrogen; Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:29 | 0 | ||
|
pET20b-mPTER-Y263F Resource Report Resource Website |
RRID:Addgene_222204 | PTER | Mus musculus | Ampicillin | PMID:38562797 | Please visit https://doi.org/10.1101/2024.03.21.586194 for bioRxiv preprint. | Vector Backbone:pET-20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Y263F | 2026-09-12 02:41:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
