Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Prominin 1
Vector Backbone Description: Backbone Marker:Nathan D. Lawson; Backbone Size:4072; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.
Proper citation: RRID:Addgene_210822 Copy
Species: Homo sapiens
Genetic Insert: Prominin 1
Vector Backbone Description: Backbone Marker:Nathan D. Lawson; Backbone Size:4736; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.
Proper citation: RRID:Addgene_210820 Copy
Species: Homo sapiens
Genetic Insert: TAF5 full length
Vector Backbone Description: Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209047 Copy
Species: Homo sapiens
Genetic Insert: APOBEC1-YTH-HA
Vector Backbone Description: Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39009472
Comments: 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc
Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_209322 Copy
Species: Homo sapiens
Genetic Insert: TAF5 deltaexon-8
Vector Backbone Description: Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209048 Copy
Species: other
Genetic Insert: Chrimson
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32541962
Proper citation: RRID:Addgene_209202 Copy
Species: Homo sapiens
Genetic Insert: APOBEC1--YTHmut-HA
Vector Backbone Description: Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39009472
Comments: 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc
Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_209323 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209057 Copy
Species: Homo sapiens
Genetic Insert: TAF5 deltaexon-8
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209050 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209058 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209059 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018
Proper citation: RRID:Addgene_210165 Copy
Species: Homo sapiens
Genetic Insert: WDHD1:M1-E1129
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBiT3.1-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39495097
Comments: 5' Cloning Site: Xho1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed).
Proper citation: RRID:Addgene_211134 Copy
Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222724 Copy
Species: Homo sapiens
Genetic Insert: NEK2 shRNA1
Vector Backbone Description: Backbone Marker:Dr. Johannes Zuber; Vector Backbone:LT3GEPIR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220540 Copy
Vector Backbone Description: Vector Backbone:pNP1742 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222729 Copy
Species: Streptococcus pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pEF_dCas9 (Addgene #68416); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_219825 Copy
Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP555 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222726 Copy
Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222728 Copy
Vector Backbone Description: Vector Backbone:pNP557 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222727 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
