Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag Resource Report Resource Website |
RRID:Addgene_210820 | Prominin 1 | Homo sapiens | Ampicillin | PMID:39168849 | Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint. Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9. | Backbone Marker:Nathan D. Lawson; Backbone Size:4736; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 0 | |
|
pDONR223-TAF5-FL Resource Report Resource Website |
RRID:Addgene_209047 | TAF5 full length | Homo sapiens | Spectinomycin | PMID:38917794 | Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-09-12 02:40:54 | 0 | ||
|
AAV-APOBEC1-YTH-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_209322 | APOBEC1-YTH-HA | Homo sapiens | Ampicillin | PMID:39009472 | 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint. | Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 1 | |
|
pDONR223-TAF5-∆ex8 Resource Report Resource Website |
RRID:Addgene_209048 | TAF5 deltaexon-8 | Homo sapiens | Spectinomycin | PMID:38917794 | Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-09-12 02:40:54 | 0 | ||
|
pAAV-CAG-FLEX-Chrimson-TdTomato Resource Report Resource Website |
RRID:Addgene_209202 | Chrimson | other | Ampicillin | PMID:32541962 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 0 | ||
|
AAV-APOBEC1-YTHmut-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_209323 | APOBEC1--YTHmut-HA | Homo sapiens | Ampicillin | PMID:39009472 | 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint. | Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin | YTH domain lacks AA 385-409 comprising the m6A-binding region | 2026-09-12 02:40:54 | 1 |
|
pDONR223-EGFP Resource Report Resource Website |
RRID:Addgene_209057 | EGFP | Aequorea victoria | Spectinomycin | PMID:38917794 | Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-09-12 02:40:54 | 0 | ||
|
pcDNA5-3xFLAG-TAF5-∆ex8 Resource Report Resource Website |
RRID:Addgene_209050 | TAF5 deltaexon-8 | Homo sapiens | Ampicillin | PMID:38917794 | Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 0 | ||
|
pcDNA5-3xFLAG-EGFP Resource Report Resource Website |
RRID:Addgene_209058 | EGFP | Aequorea victoria | Ampicillin | PMID:38917794 | Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 0 | ||
|
pcDNA5-miniTurbo-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_209059 | EGFP | Aequorea victoria | Ampicillin | PMID:38917794 | Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 2 | ||
|
pRH3128 Resource Report Resource Website |
RRID:Addgene_210165 | YIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1 | Saccharomyces cerevisiae | Ampicillin | PMID:37729018 | Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:54 | 0 | ||
|
pBiT3.1-N_WDHD1:1-1129 Resource Report Resource Website |
RRID:Addgene_211134 | WDHD1:M1-E1129 | Homo sapiens | Kanamycin | PMID:39495097 | 5' Cloning Site: Xho1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed). | Backbone Marker:Promega; Vector Backbone:pBiT3.1-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | wild type | 2026-09-12 02:40:54 | 0 |
|
pNP566 Resource Report Resource Website |
RRID:Addgene_222724 | IS621 Recombinase | E. coli | Chloramphenicol | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:41:22 | 0 | |
|
LT3GEPIR-NEK2shRNA1 Resource Report Resource Website |
RRID:Addgene_220540 | NEK2 shRNA1 | Homo sapiens | Ampicillin | Backbone Marker:Dr. Johannes Zuber; Vector Backbone:LT3GEPIR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:23 | 0 | |||
|
pNP1950 Resource Report Resource Website |
RRID:Addgene_222729 | Chloramphenicol | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP1742 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:41:22 | 0 | |||
|
CMV-dCas9_puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_219825 | dCas9 | Streptococcus pyogenes | Ampicillin | Backbone Size:4600; Vector Backbone:pEF_dCas9 (Addgene #68416); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A/H841A | 2026-09-12 02:41:23 | 1 | ||
|
pNP1047 Resource Report Resource Website |
RRID:Addgene_222726 | IS621 bridge RNA | E. coli | Kanamycin | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP555 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:41:22 | 0 | |
|
pNP1830 Resource Report Resource Website |
RRID:Addgene_222728 | IS621 Recombinase | E. coli | Chloramphenicol | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:41:22 | 0 | |
|
pNP1723 Resource Report Resource Website |
RRID:Addgene_222727 | Kanamycin | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP557 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:41:22 | 0 | |||
|
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_219828 | Ampicillin | Backbone Size:2700; Vector Backbone:pUC19 (Addgene #50005); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:23 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
