Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
 
Resource Report
Resource Website
RRID:Addgene_210820 Prominin 1 Homo sapiens Ampicillin PMID:39168849 Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint. Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9. Backbone Marker:Nathan D. Lawson; Backbone Size:4736; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 0
pDONR223-TAF5-FL
 
Resource Report
Resource Website
RRID:Addgene_209047 TAF5 full length Homo sapiens Spectinomycin PMID:38917794 Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-09-12 02:40:54 0
AAV-APOBEC1-YTH-EGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_209322 APOBEC1-YTH-HA Homo sapiens Ampicillin PMID:39009472 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint. Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 1
pDONR223-TAF5-∆ex8
 
Resource Report
Resource Website
RRID:Addgene_209048 TAF5 deltaexon-8 Homo sapiens Spectinomycin PMID:38917794 Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-09-12 02:40:54 0
pAAV-CAG-FLEX-Chrimson-TdTomato
 
Resource Report
Resource Website
RRID:Addgene_209202 Chrimson other Ampicillin PMID:32541962 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 0
AAV-APOBEC1-YTHmut-EGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_209323 APOBEC1--YTHmut-HA Homo sapiens Ampicillin PMID:39009472 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint. Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin YTH domain lacks AA 385-409 comprising the m6A-binding region 2026-09-12 02:40:54 1
pDONR223-EGFP
 
Resource Report
Resource Website
RRID:Addgene_209057 EGFP Aequorea victoria Spectinomycin PMID:38917794 Vector Backbone:pDONR223; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-09-12 02:40:54 0
pcDNA5-3xFLAG-TAF5-∆ex8
 
Resource Report
Resource Website
RRID:Addgene_209050 TAF5 deltaexon-8 Homo sapiens Ampicillin PMID:38917794 Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 0
pcDNA5-3xFLAG-EGFP
 
Resource Report
Resource Website
RRID:Addgene_209058 EGFP Aequorea victoria Ampicillin PMID:38917794 Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 0
pcDNA5-miniTurbo-EGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_209059 EGFP Aequorea victoria Ampicillin PMID:38917794 Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 2
pRH3128
 
Resource Report
Resource Website
RRID:Addgene_210165 YIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1 Saccharomyces cerevisiae Ampicillin PMID:37729018 Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:54 0
pBiT3.1-N_WDHD1:1-1129
 
Resource Report
Resource Website
RRID:Addgene_211134 WDHD1:M1-E1129 Homo sapiens Kanamycin PMID:39495097 5' Cloning Site: Xho1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed). Backbone Marker:Promega; Vector Backbone:pBiT3.1-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin wild type 2026-09-12 02:40:54 0
pNP566
 
Resource Report
Resource Website
RRID:Addgene_222724 IS621 Recombinase E. coli Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:41:22 0
LT3GEPIR-NEK2shRNA1
 
Resource Report
Resource Website
RRID:Addgene_220540 NEK2 shRNA1 Homo sapiens Ampicillin Backbone Marker:Dr. Johannes Zuber; Vector Backbone:LT3GEPIR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:41:23 0
pNP1950
 
Resource Report
Resource Website
RRID:Addgene_222729 Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP1742 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:41:22 0
CMV-dCas9_puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_219825 dCas9 Streptococcus pyogenes Ampicillin Backbone Size:4600; Vector Backbone:pEF_dCas9 (Addgene #68416); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A/H841A 2026-09-12 02:41:23 1
pNP1047
 
Resource Report
Resource Website
RRID:Addgene_222726 IS621 bridge RNA E. coli Kanamycin PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP555 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:41:22 0
pNP1830
 
Resource Report
Resource Website
RRID:Addgene_222728 IS621 Recombinase E. coli Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:41:22 0
pNP1723
 
Resource Report
Resource Website
RRID:Addgene_222727 Kanamycin PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP557 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:41:22 0
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_219828 Ampicillin Backbone Size:2700; Vector Backbone:pUC19 (Addgene #50005); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:23 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.