Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Addgene #155048; Vector Backbone:pLCHKO; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Comments: Carrying ccdB gene as stuffer that is replaced during guide cloning. After cloning guides, use NEB Stable bacterial growth strains to amplify plasmid.
Proper citation: RRID:Addgene_209025 Copy
Species: Synthetic
Genetic Insert: intergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209026 Copy
Species: Synthetic
Genetic Insert: TNT4, TadA8e, SpRY N, inteinN
Vector Backbone Description: Backbone Size:7172; Vector Backbone:pAAV-CMV-TadA8e-SpG N aa2-713-InteinN; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38805581
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.06.29.546982v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_209786 Copy
Species: Synthetic
Genetic Insert: hgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209032 Copy
Species: Synthetic
Genetic Insert: hgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209033 Copy
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Comments: Carrying ccdB gene as stuffer that is replaced during guide cloning. After cloning guides, use NEB Stable bacterial growth strains to amplify plasmid.
Proper citation: RRID:Addgene_209034 Copy
Vector Backbone Description: Vector Backbone: pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Comments: Carrying ccdB gene as stuffer that is replaced during guide cloning. After cloning guides, use NEB Stable bacterial growth strains to amplify plasmid.
Proper citation: RRID:Addgene_209035 Copy
Species: Aequorea victoria
Genetic Insert: mCerulean
Vector Backbone Description: Backbone Marker:Host-Microbe Interactions lab; Vector Backbone:pUdO1a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38235654
Proper citation: RRID:Addgene_210254 Copy
Species: Synthetic
Genetic Insert: V3-FETCH1
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38979618
Comments: Gibson cloning used NdeI (5') and SalI (3') sites
Proper citation: RRID:Addgene_210650 Copy
Species: Synthetic
Genetic Insert: sFLAG-p5-PRB4_R7-9-FETCH1
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38979618
Comments: Gibson cloning used NdeI (5') and SalI (3') sites
Proper citation: RRID:Addgene_210651 Copy
Species: Homo sapiens
Genetic Insert: APOBEC1-YTH-HA
Vector Backbone Description: Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5436; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39009472
Comments: 5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:WPRE-HindIII-SD-HA-clone-R: tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt
Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_209319 Copy
Species: Synthetic
Genetic Insert: mTagBFP2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5228; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
Proper citation: RRID:Addgene_210824 Copy
Species: Synthetic
Genetic Insert: intergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
Vector Backbone Description: Vector Backbone:pLCHKOv3-Cherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209037 Copy
Species: Streptococcus pyogenes
Genetic Insert: APOBEC1-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209039 Copy
Species: Streptococcus pyogenes
Genetic Insert: nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209043 Copy
Species: Streptococcus pyogenes
Genetic Insert: TadA8e-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209044 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::ARO7-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018
Proper citation: RRID:Addgene_210143 Copy
Vector Backbone Description: Backbone Marker:Addgene #73311; Vector Backbone:pLCKO; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209046 Copy
Species: Streptococcus pyogenes
Genetic Insert: evoCDA1-nSpCas9
Vector Backbone Description: Backbone Marker:Addgene #87360; Vector Backbone:TLCV2 inducible lentiviral plasmid; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209042 Copy
Species: Homo sapiens
Genetic Insert: Prominin 1
Vector Backbone Description: Backbone Marker:Nathan D. Lawson; Backbone Size:4072; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39168849
Comments: Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.
Proper citation: RRID:Addgene_210821 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
