Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pRSF-G1(4/5FTrp)RS Resource Report Resource Website |
RRID:Addgene_207620 | tRNA synthetase | Methanogenic archaeon ISO4-G1 | Kanamycin | PMID:38687675 | Backbone Size:2452; Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:40:53 | 0 | ||
|
ClhN-p1k-Vrg4-V5-APEX2-URA Resource Report Resource Website |
RRID:Addgene_207071 | Vrg4 | Saccharomyces cerevisiae | Ampicillin | PMID:35727034 | Vector Backbone:ClhN-URA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
pLenti-enCas12a-2xNLS Resource Report Resource Website |
RRID:Addgene_209021 | enCas12a-2xNLS-Myc-NeoR | Acidaminococcus sp | Ampicillin | PMID:38917794 | Backbone Marker:Addgene #155046; Vector Backbone:plenti-Lb-Cas12a-2xNLS; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | E174R/S542R/K548R | 2026-09-12 02:40:53 | 0 | |
|
RNF169-Halo HRD Resource Report Resource Website |
RRID:Addgene_207083 | HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
SSH-pcDNA3.1-α-COPI-WD40-Arg13Ala Resource Report Resource Website |
RRID:Addgene_208172 | N-terminal WD40 domain of yeast α-COPI(1-327);six substitutions(Arg13Ala, Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys, Phe197Lys) | Schizosaccharomyces pombe | Ampicillin | PMID:38102143 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Arg13Ala, Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys, Phe197Lys | 2026-09-12 02:40:53 | 0 | |
|
Anti-Nav1.7 Na+ channel [N68/6R-1] Resource Report Resource Website |
RRID:Addgene_206717 | anti-Nav1.7 Na+ channel (Homo sapiens) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941288. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |
|
ATM N-terminal sgRNA Resource Report Resource Website |
RRID:Addgene_207089 | ATCATTAAGTACTAGACTCA | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
SSH-pSUMO-α-COPI-WD40 Resource Report Resource Website |
RRID:Addgene_208341 | N-terminal WD40 domain of yeast α-COPI (1-327) with substitutions (Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Phe197Lys) | Schizosaccharomyces pombe | Ampicillin | PMID:38102143 | Vector Backbone:pSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Phe197Lys | 2026-09-12 02:40:53 | 0 | |
|
BS-TRP1-TetOff(7repeats)-GFP-Pho8 Resource Report Resource Website |
RRID:Addgene_207011 | Pho8 | Saccharomyces cerevisiae | Ampicillin | PMID:34088313 | Vector Backbone:BS-TRP1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
Ypq2-2GFP-URA Resource Report Resource Website |
RRID:Addgene_207010 | YPQ2 | Saccharomyces cerevisiae | Ampicillin | PMID:34088313 | Vector Backbone:KT209; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
ATM C-terminal sgRNA Resource Report Resource Website |
RRID:Addgene_207097 | TTTCTAAAGGCTGAATGAAA | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
iNos-eGFP Resource Report Resource Website |
RRID:Addgene_207251 | iNos Promoter | Mus musculus | Ampicillin | PMID:37091169 | To generate the iNos-eGFP plasmid, a 1825 -bp XhoI/BamHI fragment was isolated from a ppGL2-NOS2 Promoter-Luciferase construct (Addgene plasmid # 19296, deposited by Charles Lowenste). The iNos fragment was subcloned into the lentiviral construct pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid #12252, deposited by Didier Trono to generate a PER2-luciferase reporter construct. | Backbone Marker:Trono Lab; Backbone Size:7388; Vector Backbone:pRRLSIN.cPPT.PGK-GFP.WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |
|
Anti-Kvbeta1.2/KCNAB1 K+ channel [K47/9R] Resource Report Resource Website |
RRID:Addgene_206604 | anti-Kvbeta1.2/KCNAB1 K+ channel (Homo sapiens) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941177. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
CEL-Frb-EGFP-HOTag3 Resource Report Resource Website |
RRID:Addgene_208748 | CEL-Frb-EGFP-HOTag3 | Ampicillin | PMID:37521779 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |||
|
pET28-RPL3-1~41-mEGFP(A206K)-TwStrep Resource Report Resource Website |
RRID:Addgene_208628 | human RPL3 (ENST00000216146) aa 1~41 | Homo sapiens | Kanamycin | Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | only aa 1~41, other residues not included | 2026-09-12 02:40:53 | 0 | ||
|
ZIF-NLS-EGFP(Y66F)-HOTag6 Resource Report Resource Website |
RRID:Addgene_208749 | ZIF-NLS-EGFP(Y66F)-HOTag6 | Homo sapiens | Ampicillin | PMID:37521779 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
Anti-CASPR2 [K67/11R] Resource Report Resource Website |
RRID:Addgene_206606 | anti-CASPR2 (Homo sapiens) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941179. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
CEL-eGFP-HoTag3 Resource Report Resource Website |
RRID:Addgene_208744 | CEL-eGFP-HoTag3 | Ampicillin | PMID:37521779 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |||
|
ZIF-eGFP-HoTag6 Resource Report Resource Website |
RRID:Addgene_208745 | ZIF-eGFP-HoTag6 | Ampicillin | PMID:37521779 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |||
|
pET28-RPL3-72~197-mEGFP(A206K)-TwStrep Resource Report Resource Website |
RRID:Addgene_208625 | human RPL3 (ENST00000216146) aa 72~197 | Homo sapiens | Kanamycin | Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | only aa 72~197, other residues not included | 2026-09-12 02:40:53 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
