Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Vrg4
Vector Backbone Description: Vector Backbone:ClhN-URA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35727034
Proper citation: RRID:Addgene_207071 Copy
Species: Acidaminococcus sp
Genetic Insert: enCas12a-2xNLS-Myc-NeoR
Vector Backbone Description: Backbone Marker:Addgene #155046; Vector Backbone:plenti-Lb-Cas12a-2xNLS; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38917794
Proper citation: RRID:Addgene_209021 Copy
Species: Homo sapiens
Genetic Insert: HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207083 Copy
Species: Schizosaccharomyces pombe
Genetic Insert: N-terminal WD40 domain of yeast α-COPI(1-327);six substitutions(Arg13Ala, Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys, Phe197Lys)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38102143
Proper citation: RRID:Addgene_208172 Copy
Species: Mus musculus
Genetic Insert: anti-Nav1.7 Na+ channel (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941288. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206717 Copy
Species: Homo sapiens
Genetic Insert: ATCATTAAGTACTAGACTCA
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207089 Copy
Species: Schizosaccharomyces pombe
Genetic Insert: N-terminal WD40 domain of yeast α-COPI (1-327) with substitutions (Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Phe197Lys)
Vector Backbone Description: Vector Backbone:pSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38102143
Proper citation: RRID:Addgene_208341 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Pho8
Vector Backbone Description: Vector Backbone:BS-TRP1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088313
Proper citation: RRID:Addgene_207011 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YPQ2
Vector Backbone Description: Vector Backbone:KT209; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088313
Proper citation: RRID:Addgene_207010 Copy
Species: Homo sapiens
Genetic Insert: TTTCTAAAGGCTGAATGAAA
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207097 Copy
Species: Mus musculus
Genetic Insert: iNos Promoter
Vector Backbone Description: Backbone Marker:Trono Lab; Backbone Size:7388; Vector Backbone:pRRLSIN.cPPT.PGK-GFP.WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37091169
Comments: To generate the iNos-eGFP plasmid, a 1825 -bp XhoI/BamHI fragment was isolated from a ppGL2-NOS2 Promoter-Luciferase construct (Addgene plasmid # 19296, deposited by Charles Lowenste). The iNos fragment was subcloned into the lentiviral construct pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid #12252, deposited by Didier Trono to generate a PER2-luciferase reporter construct.
Proper citation: RRID:Addgene_207251 Copy
Species: Mus musculus
Genetic Insert: anti-Kvbeta1.2/KCNAB1 K+ channel (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941177. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206604 Copy
Genetic Insert: CEL-Frb-EGFP-HOTag3
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779
Proper citation: RRID:Addgene_208748 Copy
Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 1~41
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_208628 Copy
Species: Homo sapiens
Genetic Insert: ZIF-NLS-EGFP(Y66F)-HOTag6
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779
Proper citation: RRID:Addgene_208749 Copy
Species: Mus musculus
Genetic Insert: anti-CASPR2 (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2941179. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206606 Copy
Genetic Insert: CEL-eGFP-HoTag3
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779
Proper citation: RRID:Addgene_208744 Copy
Genetic Insert: ZIF-eGFP-HoTag6
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779
Proper citation: RRID:Addgene_208745 Copy
Species: Homo sapiens
Genetic Insert: human RPL3 (ENST00000216146) aa 72~197
Vector Backbone Description: Vector Backbone:pET28-mEGFP(A206K)-TwStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_208625 Copy
Species: Homo sapiens
Genetic Insert: CEL-IFP2-SOScat
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37521779
Proper citation: RRID:Addgene_208746 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.