Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAc5.1-mEGFP-human MDM2 1-118 (HK181) Resource Report Resource Website |
RRID:Addgene_206444 | MDM2 1-118 | Homo sapiens | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:T6-pAc5.1 mEGFP-EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mCherry-human FKBP12 (HK174) Resource Report Resource Website |
RRID:Addgene_206459 | FKBP12 | Homo sapiens | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mEGFP-Cup isoform B (JM051) Resource Report Resource Website |
RRID:Addgene_206451 | Cup | Drosophila melanogaster | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:JM050-pAc5.1 PH mEGFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mCherry-human p53 1-50 (HK180) Resource Report Resource Website |
RRID:Addgene_206458 | p53 1-50 | Homo sapiens | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mCherry-NOT3 isoform A (HK100) Resource Report Resource Website |
RRID:Addgene_206457 | NOT3 | Drosophila melanogaster | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mCherry-NOT2 isoform A (HK99) Resource Report Resource Website |
RRID:Addgene_206456 | NOT2 | Drosophila melanogaster | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pAc5.1-PH-mCherry-Oskar 139-606 isoform A (Short Oskar) (HK195) Resource Report Resource Website |
RRID:Addgene_206460 | Oskar 139-606 | Drosophila melanogaster | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:HK049-pAc5.1 PH mcherry FspAI; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pBV514 Resource Report Resource Website |
RRID:Addgene_204602 | Os Tir1 | Oryza sativa | Ampicillin | Backbone Size:3000; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Changed phenylalanine 74 into an alanine (F74A). | 2026-09-12 02:40:51 | 0 | ||
|
pBV58 Resource Report Resource Website |
RRID:Addgene_204603 | Candida glabrata ERG11 | Ampicillin | Backbone Size:2900; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:51 | 0 | ||||
|
pBV90 Resource Report Resource Website |
RRID:Addgene_204601 | Os Tir1 | Oryza sativa | Ampicillin | Backbone Size:3000; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:51 | 0 | |||
|
pTU2-a_Sv5KA_amilCP Resource Report Resource Website |
RRID:Addgene_204050 | Kanamycin | Vector Backbone:Synthetic; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | None | 2026-09-12 02:40:51 | 0 | ||||
|
pAc5.1-OST4-mCherry (EcoRV) (XH26) Resource Report Resource Website |
RRID:Addgene_206475 | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:XH26-pAc5.1 OST4 mcherry EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |||
|
pAc5.1-CCR4 isoform A-mCherry-PH (EB7) Resource Report Resource Website |
RRID:Addgene_206473 | CCR4 | Drosophila melanogaster | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:EB03-pAc5.1 FspAI mcherry PH ; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
PER2:Luc Plasmid Resource Report Resource Website |
RRID:Addgene_206875 | Period 2 | Mus musculus | Ampicillin | PMID:30943793 | For generation of PER2-luciferase (PER2:Luc) plasmid, a 159-bp EcoRI/NotI fragment was isolated from a pGL3 basic PER2 construct, obtained from Addgene (plasmid #48747, deposited by Dr Joseph Takahashi). The PER2 promoter-containing fragment was subcloned into the lentiviral construct pMA3160 (Addgene plasmid #35043, deposited by Dr Mikhail Alexeyev) to generate a PER2-luciferase reporter construct. | Backbone Marker:Alexeyev Lab; Backbone Size:8331; Vector Backbone:pMA3160; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | |
|
T5-pAc5.1 EGFP-EcoRV Resource Report Resource Website |
RRID:Addgene_206481 | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:pAc5.1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |||
|
I14-pAc5.1 lambda N HA Cup Resource Report Resource Website |
RRID:Addgene_206493 | Ampicillin | PMID:38570497 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482790v2 for bioRxiv preprint. | Vector Backbone:T8-pAC5.1 lambda N HA EcoRV; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |||
|
Halo-MDC1 PST deletion Resource Report Resource Website |
RRID:Addgene_207109 | HaloTag-MDC1 PST deletion | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:5000; Vector Backbone:pHTN HaloTag CMV-neo (Promega; #G7721); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
SHLD1 N-terminal sgRNA Resource Report Resource Website |
RRID:Addgene_207101 | ATGGCAGGACTATGGCAGCC | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:53 | 0 | ||
|
Anti-Olig1 [N149/25R-2b] Resource Report Resource Website |
RRID:Addgene_206656 | anti-Olig1 (Mus musculus) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941227. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:40:52 | 0 | |
|
pRSF-G1(4/5FTrp)RS Resource Report Resource Website |
RRID:Addgene_207620 | tRNA synthetase | Methanogenic archaeon ISO4-G1 | Kanamycin | PMID:38687675 | Backbone Size:2452; Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:40:53 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
