Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/209322
Proper Citation: RRID:Addgene_209322
Insert Name: APOBEC1-YTH-HA
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:39009472
Vector Backbone Description: Backbone Marker:Gift from Minmin Luo's lab; Backbone Size:5430; Vector Backbone:CAG-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: 5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for AAV-APOBEC1-YTH-EGFP.
No alerts have been found for AAV-APOBEC1-YTH-EGFP.
Source: Addgene
