URL: http://www.wormbase.org/db/get?name=WBStrain00051808
Proper Citation: RRID:WB-STRAIN:WBStrain00051808
Description: Caenorhabditis elegans with name mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. from WB.
Species: Caenorhabditis elegans
Synonyms: mod-5(vlc47[mod-5::T2A::mNeonGreen]) I.
Notes: Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"
Affected Gene: WBGene00003387(mod-5)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for mod-5(vlc47[mod-5::T2A::mNeonGreen]) I..
No alerts have been found for mod-5(vlc47[mod-5::T2A::mNeonGreen]) I..
Source: Integrated Animals
Source Database: WormBase (WB)