URL: http://www.addgene.org/61252
Proper Citation: RRID:Addgene_61252
Insert Name: sgRNA(F+E) targeting pha-1
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:25491644
Vector Backbone Description: Backbone Marker:Jordan Ward; Backbone Size:8146; Vector Backbone:pJW1219; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Target sequence: atgaataacttgatgaacat
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pJW1285.
No alerts have been found for pJW1285.
Source: Addgene